ID: 955444422_955444427

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 955444422 955444427
Species Human (GRCh38) Human (GRCh38)
Location 3:58994275-58994297 3:58994321-58994343
Sequence CCTGCAGTGCTCTCATTGCTCAC AGATTCATTACAGATGGCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 159} {0: 1, 1: 0, 2: 0, 3: 9, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!