ID: 955508794_955508797

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 955508794 955508797
Species Human (GRCh38) Human (GRCh38)
Location 3:59658712-59658734 3:59658761-59658783
Sequence CCAGCTGGTGGTCTACTGGTACC AGAAAGGAGAGAGATAGAAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!