ID: 955565489_955565497

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 955565489 955565497
Species Human (GRCh38) Human (GRCh38)
Location 3:60239901-60239923 3:60239944-60239966
Sequence CCTATTATTGGCCTTATGACCAC CTAAGCCTCAGTTTCTCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95} {0: 1, 1: 0, 2: 3, 3: 38, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!