ID: 955566736_955566742

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 955566736 955566742
Species Human (GRCh38) Human (GRCh38)
Location 3:60255514-60255536 3:60255545-60255567
Sequence CCCAACTTCTCACCAACTGCTTT GAATGAAGGCCCTGAGTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 268} {0: 1, 1: 0, 2: 1, 3: 11, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!