ID: 955575746_955575751

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 955575746 955575751
Species Human (GRCh38) Human (GRCh38)
Location 3:60360990-60361012 3:60361033-60361055
Sequence CCACAAATTCATATACCTCCCAC AATACTGGTGTAATACATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 770} {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!