ID: 955600634_955600638

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 955600634 955600638
Species Human (GRCh38) Human (GRCh38)
Location 3:60641815-60641837 3:60641841-60641863
Sequence CCTCTGCAACTTTGAAGAGAAAT CTATTTTCAGAGGTGGAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 272} {0: 1, 1: 0, 2: 4, 3: 42, 4: 566}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!