ID: 955614082_955614084

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 955614082 955614084
Species Human (GRCh38) Human (GRCh38)
Location 3:60787322-60787344 3:60787351-60787373
Sequence CCATCCTTCTGAGCACTGCTCAA CATCCTCAGAGAAGCTCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 299} {0: 1, 1: 1, 2: 6, 3: 46, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!