ID: 955638546_955638547

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 955638546 955638547
Species Human (GRCh38) Human (GRCh38)
Location 3:61056665-61056687 3:61056684-61056706
Sequence CCACAGAGGAAGGACAGATGACC GACCCACACCTTTTTCAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 431} {0: 1, 1: 0, 2: 1, 3: 6, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!