|
Left Crispr |
Right Crispr |
| Crispr ID |
955641613 |
955641617 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:61091762-61091784
|
3:61091777-61091799
|
| Sequence |
CCATGGCAAAACCCAGTCTCTAC |
GTCTCTACAAAAATTTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 67, 2: 250, 3: 1226, 4: 2826} |
{0: 2, 1: 117, 2: 621, 3: 1053, 4: 1307} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|