ID: 955701943_955701949

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 955701943 955701949
Species Human (GRCh38) Human (GRCh38)
Location 3:61690331-61690353 3:61690367-61690389
Sequence CCCTTTCTGGGTGTTTGTTGCAG CTGCTTTTCTCCAGGATAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 252} {0: 1, 1: 0, 2: 1, 3: 29, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!