ID: 955732449_955732455

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 955732449 955732455
Species Human (GRCh38) Human (GRCh38)
Location 3:62000863-62000885 3:62000901-62000923
Sequence CCCTGGATCATCTGCTTTCCCAG GGTGTCAAAATAGCCCAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 219} {0: 1, 1: 1, 2: 0, 3: 8, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!