ID: 955737702_955737706

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 955737702 955737706
Species Human (GRCh38) Human (GRCh38)
Location 3:62057322-62057344 3:62057345-62057367
Sequence CCTTCATCCTCCAGTTTACACTG TTTTCTGTTGTCCAGGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 224} {0: 1, 1: 0, 2: 5, 3: 39, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!