|
Left Crispr |
Right Crispr |
| Crispr ID |
955739357 |
955739363 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:62073722-62073744
|
3:62073737-62073759
|
| Sequence |
CCATCCACCTTGGCCTCACAAAG |
TCACAAAGTGCTGGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 1404, 2: 26762, 3: 81732, 4: 160668} |
{0: 1786, 1: 298626, 2: 265319, 3: 148850, 4: 129231} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|