ID: 955744951_955744952

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 955744951 955744952
Species Human (GRCh38) Human (GRCh38)
Location 3:62131241-62131263 3:62131257-62131279
Sequence CCACTGCTATGTGACAACGAAAA ACGAAAAACGTCTCCAGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 112} {0: 1, 1: 0, 2: 26, 3: 75, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!