|
Left Crispr |
Right Crispr |
| Crispr ID |
955745569 |
955745572 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:62136806-62136828
|
3:62136845-62136867
|
| Sequence |
CCAGTCACGTGGAACTGTGAGTC |
TTTGTAAACTGCCCAGTCTTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083} |
{0: 25, 1: 761, 2: 2454, 3: 5789, 4: 13930} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|