ID: 955749145_955749152

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 955749145 955749152
Species Human (GRCh38) Human (GRCh38)
Location 3:62169699-62169721 3:62169749-62169771
Sequence CCCAGTGCTATCCTTCTTCAAAA CTTGTGTCATTTATCAACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 257} {0: 1, 1: 1, 2: 1, 3: 18, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!