ID: 955751359_955751363

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 955751359 955751363
Species Human (GRCh38) Human (GRCh38)
Location 3:62188051-62188073 3:62188084-62188106
Sequence CCATGAGTTGTTGAGTAAAACAC AATTCTAGGGCCAGTCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134} {0: 1, 1: 1, 2: 27, 3: 218, 4: 1441}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!