ID: 955769633_955769637

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 955769633 955769637
Species Human (GRCh38) Human (GRCh38)
Location 3:62374319-62374341 3:62374348-62374370
Sequence CCCATCTCCACCTGTTTAAGGAG GAAACAGCAGAACCTCCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!