ID: 955775426_955775435

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 955775426 955775435
Species Human (GRCh38) Human (GRCh38)
Location 3:62427572-62427594 3:62427595-62427617
Sequence CCCCCAACCCCCGAGTTGTAGCA ACCAGGAATGTCTCCAGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 47, 4: 909} {0: 1, 1: 2, 2: 26, 3: 94, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!