ID: 955803244_955803254

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 955803244 955803254
Species Human (GRCh38) Human (GRCh38)
Location 3:62707317-62707339 3:62707367-62707389
Sequence CCATCCCCTGCAACCCCGGGTCT GTCCGTGATCCCAAAAAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 319} {0: 1, 1: 3, 2: 94, 3: 1323, 4: 1906}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!