ID: 955853568_955853574

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 955853568 955853574
Species Human (GRCh38) Human (GRCh38)
Location 3:63248043-63248065 3:63248062-63248084
Sequence CCTAACTGCCCAGGGGAAAGGTG GGTGATGCACAGAGGGGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 194} {0: 1, 1: 0, 2: 0, 3: 27, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!