ID: 955865387_955865391

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 955865387 955865391
Species Human (GRCh38) Human (GRCh38)
Location 3:63377035-63377057 3:63377058-63377080
Sequence CCCGTTTTTCCCAAGTACAACTG ATGTAGCTATGTATAAGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177} {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!