|
Left Crispr |
Right Crispr |
| Crispr ID |
955869176 |
955869178 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:63418550-63418572
|
3:63418567-63418589
|
| Sequence |
CCAAGACTGGGTAATTTATGAAG |
ATGAAGAAAAAGAGGTTTAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 162, 1: 3698, 2: 4503, 3: 3314, 4: 3221} |
{0: 44, 1: 1427, 2: 1782, 3: 1377, 4: 1987} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|