ID: 955884813_955884822

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 955884813 955884822
Species Human (GRCh38) Human (GRCh38)
Location 3:63586492-63586514 3:63586535-63586557
Sequence CCTTCTTCCATCCCTATCCCCAG TGAGTTTCTTGTATCCTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 89, 4: 789} {0: 1, 1: 0, 2: 1, 3: 23, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!