ID: 955909706_955909709

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 955909706 955909709
Species Human (GRCh38) Human (GRCh38)
Location 3:63847408-63847430 3:63847439-63847461
Sequence CCTAAAGTGCTGTGTCTCCAAAA CAGAAGAATGAAAAGAAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 483} {0: 1, 1: 0, 2: 8, 3: 131, 4: 1430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!