ID: 955909707_955909709

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 955909707 955909709
Species Human (GRCh38) Human (GRCh38)
Location 3:63847425-63847447 3:63847439-63847461
Sequence CCAAAAAGCTATATCAGAAGAAT CAGAAGAATGAAAAGAAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 393} {0: 1, 1: 0, 2: 8, 3: 131, 4: 1430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!