ID: 955923232_955923233

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 955923232 955923233
Species Human (GRCh38) Human (GRCh38)
Location 3:63980413-63980435 3:63980437-63980459
Sequence CCTAACTCTATGTGTGTACTATG CACTTATCACAACAACCCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 137} {0: 1, 1: 0, 2: 7, 3: 27, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!