ID: 955936954_955936957

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 955936954 955936957
Species Human (GRCh38) Human (GRCh38)
Location 3:64111137-64111159 3:64111154-64111176
Sequence CCCTCATCTGTGAAATGGGAATA GGAATAATCATACAACCTAAGGG
Strand - +
Off-target summary {0: 4, 1: 32, 2: 180, 3: 580, 4: 1372} {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!