ID: 955971984_955971992

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 955971984 955971992
Species Human (GRCh38) Human (GRCh38)
Location 3:64445410-64445432 3:64445424-64445446
Sequence CCGTCCGCGCCGCGGCCGGGAGG GCCGGGAGGGCGGGTAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 164} {0: 1, 1: 0, 2: 3, 3: 23, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!