ID: 955985411_955985416

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 955985411 955985416
Species Human (GRCh38) Human (GRCh38)
Location 3:64568645-64568667 3:64568661-64568683
Sequence CCCCTCTTTTACAGCGCCAGTTT CCAGTTTGGATAATATCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 101} {0: 1, 1: 0, 2: 0, 3: 11, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!