ID: 956066535_956066539

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 956066535 956066539
Species Human (GRCh38) Human (GRCh38)
Location 3:65402610-65402632 3:65402638-65402660
Sequence CCTGTTTTTCAAAGTGATTCCTA TGTGACGATCTCAACTCTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 295} {0: 1, 1: 0, 2: 1, 3: 4, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!