ID: 956067465_956067471

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 956067465 956067471
Species Human (GRCh38) Human (GRCh38)
Location 3:65412189-65412211 3:65412215-65412237
Sequence CCTCCACTGCGGAACTGCCTCCT AATTCTCTGGGCATTTTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 178} {0: 1, 1: 0, 2: 1, 3: 17, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!