ID: 956097878_956097881

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 956097878 956097881
Species Human (GRCh38) Human (GRCh38)
Location 3:65736607-65736629 3:65736621-65736643
Sequence CCGAAGACCCAGAAACCAAGAGC ACCAAGAGCTCCAATGTCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 286} {0: 2, 1: 10, 2: 42, 3: 101, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!