|
Left Crispr |
Right Crispr |
| Crispr ID |
956097879 |
956097886 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:65736614-65736636
|
3:65736635-65736657
|
| Sequence |
CCCAGAAACCAAGAGCTCCAATG |
TGTCCAAGGGCAGGAGAAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 4, 3: 33, 4: 239} |
{0: 66, 1: 148, 2: 252, 3: 392, 4: 715} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|