ID: 956097879_956097887

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 956097879 956097887
Species Human (GRCh38) Human (GRCh38)
Location 3:65736614-65736636 3:65736636-65736658
Sequence CCCAGAAACCAAGAGCTCCAATG GTCCAAGGGCAGGAGAAGATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 33, 4: 239} {0: 9, 1: 30, 2: 70, 3: 135, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!