|
Left Crispr |
Right Crispr |
| Crispr ID |
956118279 |
956118285 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:65940572-65940594
|
3:65940604-65940626
|
| Sequence |
CCCACTTCCTTACACCATCACAT |
TGATTTCAACATATAAATTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 66, 3: 437, 4: 1539} |
{0: 4, 1: 90, 2: 720, 3: 2184, 4: 4376} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|