|
Left Crispr |
Right Crispr |
Crispr ID |
956118279 |
956118287 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:65940572-65940594
|
3:65940606-65940628
|
Sequence |
CCCACTTCCTTACACCATCACAT |
ATTTCAACATATAAATTTTGGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 4, 2: 66, 3: 437, 4: 1539} |
{0: 37, 1: 485, 2: 1463, 3: 3072, 4: 4805} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|