ID: 956119000_956119004

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 956119000 956119004
Species Human (GRCh38) Human (GRCh38)
Location 3:65947141-65947163 3:65947157-65947179
Sequence CCCGAGCTTGTGTTTCCTGTAGT CTGTAGTTCTTCAAGGAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 172} {0: 1, 1: 0, 2: 0, 3: 21, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!