ID: 956143031_956143038

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 956143031 956143038
Species Human (GRCh38) Human (GRCh38)
Location 3:66164803-66164825 3:66164849-66164871
Sequence CCTGCACAAAATCAGGGTTCTCT TAACTGGATCTGCCACAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 38, 4: 262} {0: 1, 1: 0, 2: 0, 3: 13, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!