ID: 956171583_956171591

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 956171583 956171591
Species Human (GRCh38) Human (GRCh38)
Location 3:66437647-66437669 3:66437693-66437715
Sequence CCACTTGGTCCCTCAGAGTCATT TGCTACATGCAGCTGCTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 143} {0: 1, 1: 0, 2: 0, 3: 21, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!