ID: 956175383_956175386

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 956175383 956175386
Species Human (GRCh38) Human (GRCh38)
Location 3:66468361-66468383 3:66468383-66468405
Sequence CCATTTTTCAACATTAACAGAAT TAATTCAAAGTGGAAGGAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 485} {0: 1, 1: 0, 2: 5, 3: 36, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!