ID: 956246239_956246248

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 956246239 956246248
Species Human (GRCh38) Human (GRCh38)
Location 3:67186472-67186494 3:67186520-67186542
Sequence CCATTCTGGGTTCTAGAGGATGG ACTAGGCAGTACCTCAGTGTGGG
Strand - +
Off-target summary {0: 2, 1: 101, 2: 964, 3: 1428, 4: 1811} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!