|
Left Crispr |
Right Crispr |
| Crispr ID |
956301989 |
956302000 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:67781911-67781933
|
3:67781957-67781979
|
| Sequence |
CCACCCTGCTTCAGTTCACCCTC |
CCAGTCCCAATGAGATGAACTGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 152, 1: 412, 2: 383, 3: 237, 4: 225} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|