|
Left Crispr |
Right Crispr |
| Crispr ID |
956343185 |
956343189 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:68249049-68249071
|
3:68249065-68249087
|
| Sequence |
CCTCTTGAACCTGGTGCCTTCCC |
CCTTCCCTACTGAAGGTAATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 23, 1: 82, 2: 115, 3: 103, 4: 276} |
{0: 1, 1: 3, 2: 25, 3: 67, 4: 192} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|