ID: 956350692_956350694

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 956350692 956350694
Species Human (GRCh38) Human (GRCh38)
Location 3:68332301-68332323 3:68332321-68332343
Sequence CCATAAAACTCCTAGGAGAAAAT AATATAGTAGAAAATCTTCACGG
Strand - +
Off-target summary {0: 4, 1: 15, 2: 175, 3: 1670, 4: 16329} {0: 1, 1: 0, 2: 12, 3: 81, 4: 622}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!