ID: 956388345_956388350

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 956388345 956388350
Species Human (GRCh38) Human (GRCh38)
Location 3:68744983-68745005 3:68745015-68745037
Sequence CCTTGTTCGTCAAAGTGTTACCC TTTCTTTGTGAAAGGCTTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71} {0: 1, 1: 0, 2: 2, 3: 38, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!