ID: 956388547_956388549

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 956388547 956388549
Species Human (GRCh38) Human (GRCh38)
Location 3:68747231-68747253 3:68747259-68747281
Sequence CCCACTTGTGAGTTTTCTCTCTC CTCAAACACACACACTGATACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 40, 4: 350} {0: 2, 1: 0, 2: 5, 3: 86, 4: 817}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!