ID: 956462275_956462277

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 956462275 956462277
Species Human (GRCh38) Human (GRCh38)
Location 3:69484690-69484712 3:69484715-69484737
Sequence CCTCTCTGCTGCTGGTTGTCCAG ATCTCCAGTTATCAGCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 35, 3: 154, 4: 507} {0: 1, 1: 13, 2: 25, 3: 73, 4: 467}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!