ID: 956462330_956462345

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 956462330 956462345
Species Human (GRCh38) Human (GRCh38)
Location 3:69484983-69485005 3:69485025-69485047
Sequence CCCCCCACCTTCTGCCCAGGAGG ATCCATGGCACCCAGGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 515} {0: 10, 1: 8, 2: 19, 3: 39, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!