ID: 956488460_956488464

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 956488460 956488464
Species Human (GRCh38) Human (GRCh38)
Location 3:69746298-69746320 3:69746346-69746368
Sequence CCTTTTTTTAGAACAGATCACAT CAGTGTAAAAAAATGTATCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 357} {0: 1, 1: 0, 2: 1, 3: 32, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!